Top » Catalog » SNPs » DF41

$18.00

DF41
[DF41]

DF41
hg38 Position: ChrY:14880722..14880722
Ancestral: T
Derived: C
Reference: http://dna-forums.com
ISOGG Haplogroup: R1b1a1a2a1a2c1i
Comments: Found in R-L21 (x L513 DF21 DF23 Z255 Z253) samples
Forward Primer: DF41_F ATTGGAGAATGGAAACGTCC
Reverse Primer: DF41_R TGGAGAATGGTTAGATGGGG
Reviews

Customers who bought this product also purchased
Y18513
Y18513
BY3927
BY3927
A7907
A7907
A5846
A5846
R1b-DF27 Panel
R1b-DF27 Panel
FGC4077
FGC4077
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies