Top » Catalog » SNPs » DF41

$18.00

DF41
[DF41]

DF41
hg38 Position: ChrY:14880722..14880722
Ancestral: T
Derived: C
Reference: http://dna-forums.com
ISOGG Haplogroup: R1b1a1a2a1a2c1i
Comments: Found in R-L21 (x L513 DF21 DF23 Z255 Z253) samples
Forward Primer: DF41_F ATTGGAGAATGGAAACGTCC
Reverse Primer: DF41_R TGGAGAATGGTTAGATGGGG
Reviews

Customers who bought this product also purchased
A2501
A2501
FGC4077
FGC4077
FGC46309
FGC46309
Y150210
Y150210
L51
L51
A10528
A10528
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies