Top » Catalog » SNPs » S1088

$18.00

S1088
[S1088]

S1088
hg38 Position: ChrY:14132290..14132290
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1a
Comments: Downstream of FGC5496
Forward Primer: S1088no_F TCACTGATTCCTGTGATACTGTACTG
Reverse Primer: S1088no_R TGAGATGGATTTTGCTCATTACTG
Reviews

Customers who bought this product also purchased
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
A2121
A2121
A194
A194
L21
L21
DF27
DF27
A178
A178
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies