Top » Catalog » SNPs » S1088

$18.00

S1088
[S1088]

S1088
hg38 Position: ChrY:14132290..14132290
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1a
Comments: Downstream of FGC5496
Forward Primer: S1088no_F TCACTGATTCCTGTGATACTGTACTG
Reverse Primer: S1088no_R TGAGATGGATTTTGCTCATTACTG
Reviews

Customers who bought this product also purchased
CTS3386
CTS3386
BY203693
BY203693
S1105
S1105
MC14
MC14
L21
L21
DF27
DF27
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies