Top » Catalog » SNPs » S1090

$18.00

S1090
[S1090]

S1090
hg38 Position: ChrY:14985668..14985668
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of FGC5496
Forward Primer: S1090_F CAATCTACATTCAACAGGAGGAAC
Reverse Primer: S1090_R CTGTCATTCGATCACTTACTTGATTG
Reviews

Customers who bought this product also purchased
Z16502
Z16502
Z39589
Z39589
A2121
A2121
L513
L513
FGC7448
FGC7448
DF49
DF49
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies