Top » Catalog » SNPs » S1090

$18.00

S1090
[S1090]

S1090
hg38 Position: ChrY:14985668..14985668
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of FGC5496
Forward Primer: S1090_F CAATCTACATTCAACAGGAGGAAC
Reverse Primer: S1090_R CTGTCATTCGATCACTTACTTGATTG
Reviews

Customers who bought this product also purchased
Z255
Z255
FGC5521
FGC5521
Z253
Z253
CTS2457
CTS2457
FGC11134
FGC11134
Z16502
Z16502
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies