Top » Catalog » SNPs » S1090

$18.00

S1090
[S1090]

S1090
hg38 Position: ChrY:14985668..14985668
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of FGC5496
Forward Primer: S1090_F CAATCTACATTCAACAGGAGGAAC
Reverse Primer: S1090_R CTGTCATTCGATCACTTACTTGATTG
Reviews

Customers who bought this product also purchased
DF49
DF49
A194
A194
MC14
MC14
R1b-FGC5494 Panel
R1b-FGC5494 Panel
DF13
DF13
S1105
S1105
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies