Top » Catalog » SNPs » S2202

$18.00

S2202
[S2202]

S2202
hg38 Position: ChrY:14757949..14757949
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1l3~
Comments: Downstream of FGC5496 and FGC5521
Forward Primer: S2202_F TGCTCTGTTACGCAGACTGG
Reverse Primer: S2202_R AGCAAAAGCTGGTGGAAATG
Reviews

Customers who bought this product also purchased
S1954
S1954
S4706
S4706
I1-Z140 Panel
I1-Z140 Panel
S2195
S2195
A376
A376
S1990
S1990
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies