Top » Catalog » SNPs » S425

$18.00

S425
[S425]

S425
hg38 Position: ChrY:16600142..16600142
Ancestral: A
Derived: G
Reference: Jim Wilson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1g1b1a1
Comments: Downstream of DF21 Z633
Forward Primer: S425_F TGAGAGTAGAAGCCCAGCCTAC
Reverse Primer: S425_R AAAGTGGTGAACCAGGATGC
Reviews

Customers who bought this product also purchased
FGC3216
FGC3216
Z17994
Z17994
Z39298
Z39298
Z29546
Z29546
FGC3903
FGC3903
Y16490
Y16490
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies