Top » Catalog » SNPs » S425

$18.00

S425
[S425]

S425
hg38 Position: ChrY:16600142..16600142
Ancestral: A
Derived: G
Reference: Jim Wilson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1g1b1a1
Comments: Downstream of DF21 Z633
Forward Primer: S425_F TGAGAGTAGAAGCCCAGCCTAC
Reverse Primer: S425_R AAAGTGGTGAACCAGGATGC
Reviews

Customers who bought this product also purchased
Z253
Z253
FGC5494
FGC5494
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Z29552
Z29552
DF41
DF41
Z255
Z255
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies