Top » Catalog » SNPs » S425

$18.00

S425
[S425]

S425
hg38 Position: ChrY:16600142..16600142
Ancestral: A
Derived: G
Reference: Jim Wilson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1g1b1a1
Comments: Downstream of DF21 Z633
Forward Primer: S425_F TGAGAGTAGAAGCCCAGCCTAC
Reverse Primer: S425_R AAAGTGGTGAACCAGGATGC
Reviews

Customers who bought this product also purchased
Z16532
Z16532
FGC3903
FGC3903
Y16490
Y16490
Y16690
Y16690
DF49
DF49
DF21
DF21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies