Top » Catalog » SNPs » DF85

$18.00

DF85
[DF85]

DF85
hg38 Position: ChrY:21172562..21172562
Ancestral: C
Derived: A
Reference: Grierson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a1
Comments: Found in NA20318 and hu2E413D
Forward Primer: trA_DF85_F TGCACAACTATATGGCAGACC
Reverse Primer: trP1_DF85_R ATTTGCCATGCCACATACC
Reviews

Customers who bought this product also purchased
BY35726
BY35726
YP4685
YP4685
BY35727
BY35727
FT410057
FT410057
BY35731
BY35731
BY81963
BY81963
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies