Top » Catalog » SNPs » S3058

$18.00

S3058
[S3058]

S3058
hg38 Position: ChrY:13572056..13572056
Ancestral: T
Derived: C
Reference: Jim Wilson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1g1b
Comments: Between DF21 and S424
Forward Primer: S3058_F CAATGCTAGTTTCTGACAAACACAAC
Reverse Primer: S3058_R AATTTTAGAGTGATCAATTTTAGAGTAAGTACC
Reviews

Customers who bought this product also purchased
Z39589
Z39589
L513
L513
FGC18205
FGC18205
DF49
DF49
DF21
DF21
CTS3386
CTS3386
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies