Top » Catalog » SNPs » S3058

$18.00

S3058
[S3058]

S3058
hg38 Position: ChrY:13572056..13572056
Ancestral: T
Derived: C
Reference: Jim Wilson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1g1b
Comments: Between DF21 and S424
Forward Primer: S3058_F CAATGCTAGTTTCTGACAAACACAAC
Reverse Primer: S3058_R AATTTTAGAGTGATCAATTTTAGAGTAAGTACC
Reviews

Customers who bought this product also purchased
FGC3903
FGC3903
Y16490
Y16490
Y16690
Y16690
Z16532
Z16532
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
DF41
DF41
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies