Top » Catalog » SNPs » S3058

$18.00

S3058
[S3058]

S3058
hg38 Position: ChrY:13572056..13572056
Ancestral: T
Derived: C
Reference: Jim Wilson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1g1b
Comments: Between DF21 and S424
Forward Primer: S3058_F CAATGCTAGTTTCTGACAAACACAAC
Reverse Primer: S3058_R AATTTTAGAGTGATCAATTTTAGAGTAAGTACC
Reviews

Customers who bought this product also purchased
Y16490
Y16490
Y16690
Y16690
Z16532
Z16532
FGC3903
FGC3903
Z29552
Z29552
L1335
L1335
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies