Top » Catalog » SNPs » Z36

$18.00

Z36
[Z36]

Z36
hg38 Position: ChrY:5093077..5093077
Ancestral: A
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2b2
Comments: downstream of R-U152*
Forward Primer: Z36_F GAGTCTTTCCACCAGCATTCCTCGATC
Reverse Primer: Z36_R GGATTGCAAACCCAAGACAAAAACTGCTAAAATAAAC
Reviews

Customers who bought this product also purchased
Y140068
Y140068
SK2076
SK2076
Y38089
Y38089
Z2103
Z2103
BY3851
BY3851
PF7563
PF7563
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies