Top » Catalog » SNPs » Z36

$18.00

Z36
[Z36]

Z36
hg38 Position: ChrY:5093077..5093077
Ancestral: A
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2b2
Comments: downstream of R-U152*
Forward Primer: Z36_F GAGTCTTTCCACCAGCATTCCTCGATC
Reverse Primer: Z36_R GGATTGCAAACCCAAGACAAAAACTGCTAAAATAAAC
Reviews

Customers who bought this product also purchased
L2
L2
A12510
A12510
PF6645
PF6645
M343
M343
A517
A517
R1b-U152 Superclade Panel
R1b-U152 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies