Top » Catalog » SNPs » M222

$18.00

M222
[M222]

M222
hg38 Position: ChrY:12790481..12790481
Ancestral: G
Derived: A
Reference: Underhill et al.
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1
Comments: .
Forward Primer: M222_F TCCACAGGGGTAAGTGAAGGAATAA
Reverse Primer: M222_R CAGCAGCTATCAGGTCAAACATAAC
Reviews

Customers who bought this product also purchased
A4697
A4697
FGC19845
FGC19845
BY18130
BY18130
BY11697
BY11697
BY21215
BY21215
A15499
A15499
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies