Top » Catalog » SNPs » DF93

$18.00

DF93
[DF93]

DF93
hg38 Position: ChrY:19472845..19472845
Ancestral: T
Derived: C
Reference: Grierson (2013)
ISOGG Haplogroup: R1b1a1a2a1a1c2a1a~
Comments: Downstream under R1b-U198/S29; Found in PGP1
Forward Primer: DF93v5_F TTGCTGGTAAGGAGCTGCC
Reverse Primer: DF93v5_R GGAGGCACCCCCTAGTAGAGA
Reviews

Customers who bought this product also purchased
S1688
S1688
FGC19573
FGC19573
A14235
A14235
S15627
S15627
L51
L51
DF98
DF98
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies