Top » Catalog » SNPs » A1152

$18.00

A1152
[A1152]

A1152
hg38 Position: ChrY:16719215..16719215
Ancestral: C
Derived: T
Reference: Hamma Bachir (2014)
ISOGG Haplogroup: E1b1b1b1a1 (not listed)
Comments: Below M183
Forward Primer: A1152_F TTCCATGTTTGCCAAGGG
Reverse Primer: A1152_R GGCAAAGGAGAGTAGCTGGC
Reviews

Customers who bought this product also purchased
BY9720
BY9720
V6588
V6588
MZ270
MZ270
Y110637
Y110637
BY9698
BY9698
BY9757
BY9757
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies