Top » Catalog » SNPs » S695

$18.00

S695
[S695]

S695
HG19 Position: ChrY:18947903..18947903
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k1 (not listed)
Comments: Downstream L1065 S744
Forward Primer: S695_F GGATAAGCTAACCCTTAGACAGAACC
Reverse Primer: S695_R CAAAGAGTTCTGTCTTTTAGGCCA
Reviews

Customers who bought this product also purchased
L1335
L1335
S1026
S1026
DF49
DF49
CTS1751
CTS1751
Z39589
Z39589
S1051
S1051
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies