Top » Catalog » SNPs » S695

$18.00

S695
[S695]

S695
hg38 Position: ChrY:16836023..16836023
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k1 (not listed)
Comments: Downstream L1065 S744
Forward Primer: S695_F GGATAAGCTAACCCTTAGACAGAACC
Reverse Primer: S695_R CAAAGAGTTCTGTCTTTTAGGCCA
Reviews

Customers who bought this product also purchased
A9019
A9019
A10652
A10652
A6091
A6091
A10738
A10738
A9880
A9880
FGC32580
FGC32580
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies