Top » Catalog » SNPs » FGC15565

$18.00

FGC15565
[FGC15565]

FGC15565
hg38 Position: ChrY:7787543..7787543
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of L1335
Forward Primer: FGC15565_F TAGGAAAAACATTCTGCAGCC
Reverse Primer: FGC15565_R GGTGTCTTTCTCACATTGCG
Reviews

Customers who bought this product also purchased
A23988
A23988
BY156842
BY156842
BY60840
BY60840
BY20833
BY20833
BY62303
BY62303
A858
A858
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies