Top » Catalog » SNPs » L238

$18.00

L238
[L238]

L238
hg38 Position: ChrY:19091557..19091557
Ancestral: A
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2d
Comments: Found in a hg R-P312 person with an Illumina chip assay
Forward Primer: L238_F AGGACAAAGAATTCTCCTGGATG
Reverse Primer: L238_R AGGCTAAGGTGGGAGGATGA
Reviews

Customers who bought this product also purchased
FGC17018
FGC17018
FGC17034
FGC17034
FGC16979
FGC16979
Y134723
Y134723
Y5049
Y5049
BY15479
BY15479
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies