Top » Catalog » SNPs » L238

$18.00

L238
[L238]

L238
hg38 Position: ChrY:19091557..19091557
Ancestral: A
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2d
Comments: Found in a hg R-P312 person with an Illumina chip assay
Forward Primer: L238_F AGGACAAAGAATTCTCCTGGATG
Reverse Primer: L238_R AGGCTAAGGTGGGAGGATGA
Reviews

Customers who bought this product also purchased
YP4295
YP4295
FGC13109
FGC13109
FGC17112
FGC17112
FGC20764
FGC20764
BY653
BY653
FGC23071
FGC23071
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies