Top » Catalog » SNPs » L238

$18.00

L238
[L238]

L238
hg38 Position: ChrY:19091557..19091557
Ancestral: A
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2d
Comments: Found in a hg R-P312 person with an Illumina chip assay
Forward Primer: L238_F AGGACAAAGAATTCTCCTGGATG
Reverse Primer: L238_R AGGCTAAGGTGGGAGGATGA
Reviews

Customers who bought this product also purchased
Y29875
Y29875
Y10824
Y10824
Z2248
Z2248
CTS11638
CTS11638
R1b-L238 Panel
R1b-L238 Panel
BY105244
BY105244
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies