Top » Catalog » SNPs » L238

$18.00

L238
[L238]

L238
hg38 Position: ChrY:19091557..19091557
Ancestral: A
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2d
Comments: Found in a hg R-P312 person with an Illumina chip assay
Forward Primer: L238_F AGGACAAAGAATTCTCCTGGATG
Reverse Primer: L238_R AGGCTAAGGTGGGAGGATGA
Reviews

Customers who bought this product also purchased
BY25512
BY25512
Z2245
Z2245
A6289
A6289
Y29875
Y29875
BY25454
BY25454
CTS11638
CTS11638
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies