Top » Catalog » SNPs » BY359

$18.00

BY359
[BY359]

BY359
hg38 Position: ChrY:8007398..8007398
Ancestral: G
Derived: A
Reference: Mike Walsh (2014)
ISOGG Haplogroup: R1b
Comments: Below L513
Forward Primer: BY359_F TAAGCATCAGCATCCTGCAC
Reverse Primer: BY359_R GGGACCTGACCACAGGAAG
Reviews

Customers who bought this product also purchased
L1333
L1333
L513
L513
Z16385
Z16385
Z39589
Z39589
CTS6621
CTS6621
DF13
DF13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies