Top » Catalog » SNPs » BY359

$18.00

BY359
[BY359]

BY359
hg38 Position: ChrY:8007398..8007398
Ancestral: G
Derived: A
Reference: Mike Walsh (2014)
ISOGG Haplogroup: R1b
Comments: Below L513
Forward Primer: BY359_F TAAGCATCAGCATCCTGCAC
Reverse Primer: BY359_R GGGACCTGACCACAGGAAG
Reviews

Customers who bought this product also purchased
Z39589
Z39589
CTS6621
CTS6621
DF13
DF13
Z16361
Z16361
Z17807
Z17807
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies