Top » Catalog » SNPs » S6365

$18.00

S6365
[S6365]

S6365
hg38 Position: ChrY:3568032..3568032
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b2
Comments: Downstream L513. Close to 47z segment. Highly similar to ChrX!
Forward Primer: S6365_F TTCTCAGCAATAAAAAGGACCTG
Reverse Primer: S6365_R GACATTGACTCATTTTTGTGTGG
Reviews

Customers who bought this product also purchased
Z17807
Z17807
FGC11791
FGC11791
BY359
BY359
L1333
L1333
Z39589
Z39589
Z17624
Z17624
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies