Top » Catalog » SNPs » S6365

$18.00

S6365
[S6365]

S6365
hg38 Position: ChrY:3568032..3568032
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1b2
Comments: Downstream L513. Close to 47z segment. Highly similar to ChrX!
Forward Primer: S6365_F TTCTCAGCAATAAAAAGGACCTG
Reverse Primer: S6365_R GACATTGACTCATTTTTGTGTGG
Reviews

Customers who bought this product also purchased
L193.1
L193.1
BY11195
BY11195
M343
M343
Z17299
Z17299
BY14108
BY14108
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies