Top » Catalog » SNPs » S764

$18.00

S764
[S764]

S764
hg38 Position: ChrY:3003927..3003927
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1k1a1
Comments: Downstream of L1065
Forward Primer: S764_F AAATGGGAGGGAAGTTGTTG
Reverse Primer: S764_R ATTTCCGCTGGTGGTTCC
Reviews

Customers who bought this product also purchased
FGC3903
FGC3903
CTS5396
CTS5396
FGC3213
FGC3213
Y2890
Y2890
S5488
S5488
S971
S971
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies