Top » Catalog » SNPs » S764

$18.00

S764
[S764]

S764
hg38 Position: ChrY:3003927..3003927
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1k1a1
Comments: Downstream of L1065
Forward Primer: S764_F AAATGGGAGGGAAGTTGTTG
Reverse Primer: S764_R ATTTCCGCTGGTGGTTCC
Reviews

Customers who bought this product also purchased
BY20833
BY20833
BY62303
BY62303
A858
A858
A18864
A18864
A13318
A13318
A18866
A18866
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies