Top » Catalog » SNPs » S764

$18.00

S764
[S764]

S764
hg38 Position: ChrY:3003927..3003927
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1k1a1
Comments: Downstream of L1065
Forward Primer: S764_F AAATGGGAGGGAAGTTGTTG
Reverse Primer: S764_R ATTTCCGCTGGTGGTTCC
Reviews

Customers who bought this product also purchased
CTS5396
CTS5396
DF27
DF27
Z38412
Z38412
P312
P312
Y22337
Y22337
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies