Top » Catalog » SNPs » L862

$18.00

L862
[L862]

L862
hg38 Position: ChrY:12142421..12142421
Ancestral: G
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: not listed
Comments: Found in a hg J-L222.2 WTY participant
Forward Primer: L862_F TTTACTTTTGAGGAAGCAATGTACTG
Reverse Primer: L862_R CTGCACCCATCAACCTGTC
Reviews

Customers who bought this product also purchased
ZS3698
ZS3698
PF4881
PF4881
Y16646
Y16646
Y136165
Y136165
M96
M96
Y138150
Y138150
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies