Top » Catalog » SNPs » L862

$18.00

L862
[L862]

L862
hg38 Position: ChrY:12142421..12142421
Ancestral: G
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: not listed
Comments: Found in a hg J-L222.2 WTY participant
Forward Primer: L862_F TTTACTTTTGAGGAAGCAATGTACTG
Reverse Primer: L862_R CTGCACCCATCAACCTGTC
Reviews

Customers who bought this product also purchased
M96
M96
Y138150
Y138150
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Y136125
Y136125
ZS3698
ZS3698
PF4881
PF4881
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies