Top » Catalog » SNPs » Z1853

$19.00

Z1853
[Z1853]

Z1853
hg38 Position: ChrY:7818962..7818962
Ancestral: C
Derived: T
Reference: http://dna-forums.org (B. Schrack 2011)
ISOGG Haplogroup: J1a1b1b1a2a
Comments: Approximately equivalent to L147 or P58
Forward Primer: Z1853v2_F AACTTAACATTGGGCTTTGGAC
Reverse Primer: Z1853v2_R CAGGTAATGTGACTCCAATTCCTATAG
Reviews

Customers who bought this product also purchased
F4256
F4256
CTS5551
CTS5551
BY192980
BY192980
FGC12
FGC12
A24503
A24503
FT130244
FT130244
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies