Top » Catalog » SNPs » S17250

$18.00

S17250
[S17250]

S17250
hg38 Position: ChrY:13419474..13419474
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2a1b2a1a
Comments: Approx. hg: I2a-CTS5966
Forward Primer: S17250_F CCTGAGTCCTAATAAAGGCTTTGG
Reverse Primer: S17250_R GCTTGGCTAAGCTATGATGCTC
Reviews

Customers who bought this product also purchased
A6105
A6105
A6036
A6036
FGC12095
FGC12095
FT256413
FT256413
PH3314
PH3314
BY118217
BY118217
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies