Top » Catalog » SNPs » S17250

$18.00

S17250
[S17250]

S17250
hg38 Position: ChrY:13419474..13419474
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2a1b2a1a
Comments: Approx. hg: I2a-CTS5966
Forward Primer: S17250_F CCTGAGTCCTAATAAAGGCTTTGG
Reverse Primer: S17250_R GCTTGGCTAAGCTATGATGCTC
Reviews

Customers who bought this product also purchased
S10860
S10860
FT14649
FT14649
A14301
A14301
FTA23185
FTA23185
FGC22844
FGC22844
BY8888
BY8888
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies