Top » Catalog » SNPs » S17250

$18.00

S17250
[S17250]

S17250
hg38 Position: ChrY:13419474..13419474
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2a1b2a1a
Comments: Approx. hg: I2a-CTS5966
Forward Primer: S17250_F CCTGAGTCCTAATAAAGGCTTTGG
Reverse Primer: S17250_R GCTTGGCTAAGCTATGATGCTC
Reviews

Customers who bought this product also purchased
FT34788
FT34788
A26390
A26390
Y152112
Y152112
Y183467
Y183467
PF4609
PF4609
L145
L145
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies