Top » Catalog » SNPs » S17250

$18.00

S17250
[S17250]

S17250
hg38 Position: ChrY:13419474..13419474
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2a1b2a1a
Comments: Approx. hg: I2a-CTS5966
Forward Primer: S17250_F CCTGAGTCCTAATAAAGGCTTTGG
Reverse Primer: S17250_R GCTTGGCTAAGCTATGATGCTC
Reviews

Customers who bought this product also purchased
Y152112
Y152112
A7134
A7134
A10959
A10959
Y39363
Y39363
Y90421
Y90421
Y100616
Y100616
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies