Top » Catalog » SNPs » FGC22503

$18.00

FGC22503
[FGC22503]

FGC22503
hg38 Position: ChrY:2876245..2876245
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2b1 (not listed)
Comments: .
Forward Primer: FGC22503_F GTCTTTTTCCTAGCCCTGTGG
Reverse Primer: FGC22503_R TTTCTGCCCAAAAGGAACAG
Reviews

Customers who bought this product also purchased
FGC22530
FGC22530
FGC22516
FGC22516
FGC22533
FGC22533
FGC22538
FGC22538
FGC22500
FGC22500
FGC22526
FGC22526
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies