Top » Catalog » SNPs » FGC22512

$18.00

FGC22512
[FGC22512]

FGC22512
hg38 Position: ChrY:6782651..6782651
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2b1 (not listed)
Comments: .
Forward Primer: FGC22512_F AAATCCCTATGGGTGGTGTG
Reverse Primer: FGC22512_R TATGCCTTCACCTCCTCTGC
Reviews

Customers who bought this product also purchased
FGC22530
FGC22530
FGC22538
FGC22538
FGC22500
FGC22500
FGC22516
FGC22516
FGC22533
FGC22533
FGC22514
FGC22514
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies