Top » Catalog » SNPs » FGC22523

$18.00

FGC22523
[FGC22523]

FGC22523
hg38 Position: ChrY:12557534..12557534
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2b1 (not listed)
Comments: .
Forward Primer: FGC22523_F AAGCTGATCAGGGAGAGACAAG
Reverse Primer: FGC22523_R CTCAACCACTTTCACAACAGC
Reviews

Customers who bought this product also purchased
FGC22516
FGC22516
FGC22533
FGC22533
FGC22538
FGC22538
FGC22500
FGC22500
R1b-FGC22503 Wheaton Panel
R1b-FGC22503 Wheaton Panel
FGC22540
FGC22540
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies