Top » Catalog » SNPs » FGC22528

$18.00

FGC22528
[FGC22528]

FGC22528
hg38 Position: ChrY:13549216..13549216
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a1a2a1a2b1d1a~
Comments: Below L2 > FGC22501 > FGC22538
Forward Primer: FGC22528_F AATGAGGGTGGATCCCAAG
Reverse Primer: FGC22528_R TTGCACCCACTTGGATAATTC
Reviews

Customers who bought this product also purchased
R1b-FGC22538 Panel
R1b-FGC22538 Panel
FGC22538
FGC22538
FGC22500
FGC22500
FGC22516
FGC22516
FGC22533
FGC22533
FGC22535
FGC22535
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY32665
1 x L1364
1 x P77
1 x A1379
1 x BY31191
1 x A6249
1 x BY122504
1 x A5494
1 x A1994
1 x A18898
1 x BY181693
1 x A6231
1 x A1353
1 x A1603
1 x A5991
1 x A1818
1 x A6003
1 x A25063
1 x A6044
1 x A407
1 x A1807
1 x BY45363
1 x A1350
1 x FT277325
1 x A5417
1 x CTS10538
1 x FGC1408
1 x A5573
1 x A5566
$522.00
Haplogroup Info
Other products
Currencies