Top » Catalog » SNPs » FGC22528

$18.00

FGC22528
[FGC22528]

FGC22528
hg38 Position: ChrY:13549216..13549216
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a1a2a1a2b1d1a~
Comments: Below L2 > FGC22501 > FGC22538
Forward Primer: FGC22528_F AATGAGGGTGGATCCCAAG
Reverse Primer: FGC22528_R TTGCACCCACTTGGATAATTC
Reviews

Customers who bought this product also purchased
R1b-FGC22538 Panel
R1b-FGC22538 Panel
FGC22516
FGC22516
FGC22533
FGC22533
FGC22538
FGC22538
FGC22500
FGC22500
FGC22519
FGC22519
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies