Top » Catalog » SNPs » FGC22529

$18.00

FGC22529
[FGC22529]

FGC22529
hg38 Position: ChrY:13589294..13589294
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2b1 (not listed)
Comments: .
Forward Primer: FGC22529_F GGAACAAGGTCATGAATGAAAC
Reverse Primer: FGC22529_R GGGGGCAAACATAACCAAG
Reviews

Customers who bought this product also purchased
FGC22530
FGC22530
FGC22500
FGC22500
FGC22516
FGC22516
FGC22533
FGC22533
FGC22538
FGC22538
FGC22534
FGC22534
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies