Top » Catalog » SNPs » FGC22539

$18.00

FGC22539
[FGC22539]

FGC22539
hg38 Position: ChrY:17048432..17048432
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2b1 (not listed)
Comments: .
Forward Primer: FGC22539_F ACCTGGGGACAACCTGAAAC
Reverse Primer: FGC22539_R TAAATGCCCTTTTTCCAAGC
Reviews

Customers who bought this product also purchased
FGC22533
FGC22533
FGC22538
FGC22538
FGC22500
FGC22500
FGC22516
FGC22516
FGC22514
FGC22514
FGC22546
FGC22546
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies