Top » Catalog » SNPs » FGC22540

$18.00

FGC22540
[FGC22540]

FGC22540
hg38 Position: ChrY:18943310..18943310
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2b1 (not listed)
Comments: .
Forward Primer: FGC22540v2_F GCAGAAAATAGTGCCAAAACC
Reverse Primer: FGC22540v2_R GGGAGGCTGTCAGGAGAATC
Reviews

Customers who bought this product also purchased
R1b-FGC22538 Panel
R1b-FGC22538 Panel
FGC22500
FGC22500
FGC22516
FGC22516
FGC22533
FGC22533
FGC22538
FGC22538
FGC22503
FGC22503
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies