Top » Catalog » SNPs » FGC22541

$18.00

FGC22541
[FGC22541]

FGC22541
hg38 Position: ChrY:19052538..19052538
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2b1 (not listed)
Comments: .
Forward Primer: FGC22541v2_F CATTAATCACAACAGCCAAAAGC
Reverse Primer: FGC22541v2_R AGGCTGTGTTCCCAGAAGG
Reviews

Customers who bought this product also purchased
FGC22530
FGC22530
FGC22538
FGC22538
FGC22500
FGC22500
FGC22516
FGC22516
FGC22533
FGC22533
FGC22512
FGC22512
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies