Top » Catalog » SNPs » FGC22547

$18.00

FGC22547
[FGC22547]

FGC22547
hg38 Position: ChrY:21035361..21035361
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a1a2a1a2b1d1a~
Comments: .
Forward Primer: FGC22547_F CCTGACCTCAGAAGATGCAC
Reverse Primer: FGC22547_R GAAGGGCCACTGAGGTAAAAC
Reviews

Customers who bought this product also purchased
R1b-FGC22538 Panel
R1b-FGC22538 Panel
FGC22516
FGC22516
FGC22533
FGC22533
FGC22538
FGC22538
FGC22500
FGC22500
FGC22525
FGC22525
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies