Top » Catalog » SNPs » A1163

$18.00

A1163
[A1163]

A1163
hg38 Position: ChrY:12052537..12052537
Ancestral: G
Derived: C
Reference: Paul Burns (2014)
ISOGG Haplogroup: R1b1a2a1a2c1e (not listed)
Comments: Below Z255. approx. Z16950
Forward Primer: A1163_F ATTTCTCATGCTTCTGGAGAGC
Reverse Primer: A1163_R AATGGACATAGCACCATCCG
Reviews

Customers who bought this product also purchased
BY2573
BY2573
A5411
A5411
L159.2
L159.2
S23035
S23035
Z255
Z255
Z16950
Z16950
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies