Top » Catalog » SNPs » A1165

$19.00

A1165
[A1165]

A1165
hg38 Position: ChrY:15582245..15582245
Ancestral: T
Derived: C
Reference: Paul Burns (2014)
ISOGG Haplogroup: R1b1a2a1a2c1e (not listed)
Comments: Below Z255. approx. Z16950
Forward Primer: A1165_F GACTGGGTTTCTGAGATCAAGC
Reverse Primer: A1165_R TTAAAATTCCACTTTAGCCCTCAA
Reviews

Customers who bought this product also purchased
A1164
A1164
A1163
A1163
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies