Top » Catalog » SNPs » M123

$18.00

M123
[M123]

M123
hg38 Position: ChrY:19602700..19602700
Ancestral: C
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: E1b1b1b2a
Comments: G3.27b
Forward Primer: M123_F CCTGCAGCGAATTAGATTTTC
Reverse Primer: M123_R TGCAAATGGTATGCAACTCAG
Reviews

Customers who bought this product also purchased
Y6966
Y6966
Z827
Z827
M35
M35
M84
M84
CTS11051
CTS11051
M78
M78
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies