Top » Catalog » SNPs » A63

$18.00

A63
[A63]

A63
hg38 Position: ChrY:19199545..19199545
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A63_F CCATTAGGCCATCCATATTACG
Reverse Primer: A63_R TGGATGCATGCAGGTAGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies