Top » Catalog » SNPs » A67

$18.00

A67
[A67]

A67
hg38 Position: ChrY:6836938..6836938
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1g1b1
Comments: Found in a R1b-DF21 person
Forward Primer: A67_F AAAATAATCAGGAGCCTAAATTCCAG
Reverse Primer: A67_R GCCCAGCTGGACCTCTG
Reviews

Customers who bought this product also purchased
Y16490
Y16490
Y16690
Y16690
Z16532
Z16532
FGC3903
FGC3903
DF41
DF41
Z255
Z255
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies