Top » Catalog » SNPs » A67

$18.00

A67
[A67]

A67
hg38 Position: ChrY:6836938..6836938
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1g1b1
Comments: Found in a R1b-DF21 person
Forward Primer: A67_F AAAATAATCAGGAGCCTAAATTCCAG
Reverse Primer: A67_R GCCCAGCTGGACCTCTG
Reviews

Customers who bought this product also purchased
Y16490
Y16490
Y16690
Y16690
Z16532
Z16532
FGC3903
FGC3903
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Z29552
Z29552
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies