Top » Catalog » SNPs » A67

$18.00

A67
[A67]

A67
hg38 Position: ChrY:6836938..6836938
Ancestral: C
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1g1b1
Comments: Found in a R1b-DF21 person
Forward Primer: A67_F AAAATAATCAGGAGCCTAAATTCCAG
Reverse Primer: A67_R GCCCAGCTGGACCTCTG
Reviews

Customers who bought this product also purchased
DF49
DF49
DF21
DF21
CTS3386
CTS3386
DF13
DF13
Z253
Z253
FGC5494
FGC5494
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies