Top » Catalog » SNPs » FGC23338

$18.00

FGC23338
[FGC23338]

FGC23338
hg38 Position: ChrY:21452278..21452278
Ancestral: C
Derived: A
Reference: George Chandler (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC23338_F CAATAAGATGTATAGCAGTGGCAGTATC
Reverse Primer: FGC23338_R GGTATGGGCTGTGTCCAATC
Reviews

Customers who bought this product also purchased
FGC17906
FGC17906
FGC33267
FGC33267
R1b-S1051 Henry Panel
R1b-S1051 Henry Panel
FGC33265
FGC33265
FGC39789
FGC39789
FGC39788
FGC39788
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies